Skip to main content

Erratum to: Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility

After publication of this article [1], an error was reported in the ‘Methods’ section of the article under the subheading ‘DNA extraction and library preparation’. The second primer associated with 926R was incorrectly stated as: “CAAGCAGAAGACGGCATACGAGATGCCGCATTCGATXXXXXXXXXXXXCCGTCAATTCMTTTRAGT”. The correct sequence for the experimental work was: “CAAGCAGAAGACGGCATACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT”.


  1. 1.

    Seto CT et al. Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome. 2014;2:42. doi:10.1186/2049-2618-2-42.

    PubMed Central  Article  PubMed  Google Scholar 

Download references

Author information



Corresponding authors

Correspondence to Nicholas Chia or John K. DiBaise.

Additional information

The online version of the original article can be found under doi:10.1186/2049-2618-2-42.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Seto, C.T., Jeraldo, P., Orenstein, R. et al. Erratum to: Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome 4, 10 (2016).

Download citation