Skip to main content
Download PDF

Erratum to: Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility

Microbiome volume 4, Article number: 10 (2016) Cite this article

The Original Article was published on 25 November 2014

After publication of this article [1], an error was reported in the ‘Methods’ section of the article under the subheading ‘DNA extraction and library preparation’. The second primer associated with 926R was incorrectly stated as: “CAAGCAGAAGACGGCATACGAGATGCCGCATTCGATXXXXXXXXXXXXCCGTCAATTCMTTTRAGT”. The correct sequence for the experimental work was: “CAAGCAGAAGACGGCATACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT”.

Reference

  1. Seto CT et al. Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome. 2014;2:42. doi:10.1186/2049-2618-2-42.

    Article  PubMed Central  PubMed  Google Scholar 

Download references

Author information

Authors and Affiliations

  1. Biomedical Informatics and Computational Biology, University of Minnesota-Rochester, Rochester, MN, USA

    Charlie T. Seto & Nicholas Chia

  2. Center for Individualized Medicine, Mayo Clinic, Rochester, MN, USA

    Charlie T. Seto, Patricio Jeraldo & Nicholas Chia

  3. Institute for Genomic Biology, University of Illinois Urbana-Champaign, Urbana, IL, USA

    Patricio Jeraldo

  4. Division of Infectious Diseases, Mayo Clinic, Scottsdale, AZ, USA

    Robert Orenstein

  5. Department of Physiology and Biomedical Engineering, Mayo Clinic, Rochester, MN, USA

    Nicholas Chia

  6. Division of Surgery Research, Mayo Clinic, Rochester, MN, USA

    Nicholas Chia

  7. Department of Health Sciences Research, Mayo Clinic, Rochester, MN, USA

    Nicholas Chia

  8. Division of Gastroenterology, Mayo Clinic, Scottsdale, AZ, USA

    John K. DiBaise

Authors
  1. Charlie T. Seto
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Patricio Jeraldo
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Robert Orenstein
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Nicholas Chia
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. John K. DiBaise
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding authors

Correspondence to Nicholas Chia or John K. DiBaise.

Additional information

The online version of the original article can be found under doi:10.1186/2049-2618-2-42.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Seto, C.T., Jeraldo, P., Orenstein, R. et al. Erratum to: Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome 4, 10 (2016). https://doi.org/10.1186/s40168-016-0158-1

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s40168-016-0158-1

Microbiome

ISSN: 2049-2618

Contact us