Reference
Seto CT et al. Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome. 2014;2:42. doi:10.1186/2049-2618-2-42.
Microbiome volume 4, Article number: 10 (2016)
After publication of this article [1], an error was reported in the ‘Methods’ section of the article under the subheading ‘DNA extraction and library preparation’. The second primer associated with 926R was incorrectly stated as: “CAAGCAGAAGACGGCATACGAGATGCCGCATTCGATXXXXXXXXXXXXCCGTCAATTCMTTTRAGT”. The correct sequence for the experimental work was: “CAAGCAGAAGACGGCATACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT”.
Seto CT et al. Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome. 2014;2:42. doi:10.1186/2049-2618-2-42.
The online version of the original article can be found under doi:10.1186/2049-2618-2-42.
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Seto, C.T., Jeraldo, P., Orenstein, R. et al. Erratum to: Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome 4, 10 (2016). https://doi.org/10.1186/s40168-016-0158-1
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s40168-016-0158-1