Skip to content


  • Erratum
  • Open Access

Erratum to: Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility


Received: 16 February 2016

Accepted: 16 February 2016

Published: 22 February 2016

The original article was published in Microbiome 2014 2:42

After publication of this article [1], an error was reported in the ‘Methods’ section of the article under the subheading ‘DNA extraction and library preparation’. The second primer associated with 926R was incorrectly stated as: “CAAGCAGAAGACGGCATACGAGATGCCGCATTCGATXXXXXXXXXXXXCCGTCAATTCMTTTRAGT”. The correct sequence for the experimental work was: “CAAGCAGAAGACGGCATACGAGAT NNNNNNNNNNNN AGTCAGTCAG CC CCGTCAATTCMTTTRAGT”.



Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

Biomedical Informatics and Computational Biology, University of Minnesota-Rochester, Rochester, USA
Center for Individualized Medicine, Mayo Clinic, Rochester, USA
Institute for Genomic Biology, University of Illinois Urbana-Champaign, Urbana, USA
Division of Infectious Diseases, Mayo Clinic, Scottsdale, USA
Department of Physiology and Biomedical Engineering, Mayo Clinic, Rochester, USA
Division of Surgery Research, Mayo Clinic, Rochester, USA
Department of Health Sciences Research, Mayo Clinic, Rochester, USA
Division of Gastroenterology, Mayo Clinic, Scottsdale, USA


  1. Seto CT et al. Prolonged use of a proton pump inhibitor reduces microbial diversity: implications for Clostridium difficile susceptibility. Microbiome. 2014;2:42. doi:10.1186/2049-2618-2-42.PubMed CentralView ArticlePubMedGoogle Scholar


© Seto et al. 2016
