Skip to main content

Table 1 Paired primers for qPCR

From: Fecal microbiota transplantation protects rotenone-induced Parkinson’s disease mice via suppressing inflammation mediated by the lipopolysaccharide-TLR4 signaling pathway through the microbiota-gut-brain axis

Gene Primer sequence (5′-3′)
Forward Reverse
Tnf ACGGCATGGATCTCAAAGAC AGATAGCAAATCGGCTGACG
Il1b GCTACCTATGTCTTGCCCGT GACCATTGCTGTTTCCTAGG
Il6 CTGCAAGAGACTTCCATCCAG AGTGGTATAGACAGGTCTGTTGG
COX2 GAAGTGGGGGTTTAGGATCATC CCTTTCACTTTCGGATAACCA
Nos2 CAGCTGGGCTGTACAAACCTT CATTGGAAGTGAAGCGTTTCG
Ocln TTACAGGCAGAACTAGACGAC TGATGTGCGATAATTTGCTCT
ZO1 TTCCCAGCTTATGAAAGGGTT TCGCTTCTTTCAGGGCACCGTA
Cldn1 GCCATCTACGAGGGACTG GAGCAGGAAAGTAGGACACC
Cldn5 ACTGCCTTCCTGGACCACAAC CGCCAGCACAGATTCATACACCT
Tlr4 AACTTCAGTGGCTGGATT ACTAGGTTCGTCAGATTGG
Gapdh ATGACTCTACCCACGGCAAG GATCTCGCTCCTGGAAGATG