Skip to main content

Table 4 Primers for qRT-PCR

From: Skin microbiota analysis-inspired development of novel anti-infectives

Target genes Orientation Sequence (5’-3’)
IL-6 Forward
Reverse
CTGCAAGAGACTTCCATCCAGTT
GGGAAGGCCGTGGTTGTC
IL-1β Forward
Reverse
TGCAGAGTTCCCCAACTGGTACATC
GTGCTGCCTAATGTCCCCTTGAATC
18S Forward
Reverse
CATTCGAACGTCTGCCCTATC
CCTGCTGCCTTCCTTGGA