Skip to main content

Table 4 Primers for qRT-PCR

From: Skin microbiota analysis-inspired development of novel anti-infectives

Target genesOrientationSequence (5’-3’)
IL-6Forward
Reverse
CTGCAAGAGACTTCCATCCAGTT
GGGAAGGCCGTGGTTGTC
IL-1βForward
Reverse
TGCAGAGTTCCCCAACTGGTACATC
GTGCTGCCTAATGTCCCCTTGAATC
18SForward
Reverse
CATTCGAACGTCTGCCCTATC
CCTGCTGCCTTCCTTGGA