Skip to main content

Table 2 Primers for amplification of variable regions of the 16S rRNA-encoding gene

From: Multiphasic analysis of the temporal development of the distal gut microbiota in patients following ileal pouch anal anastomosis

Primer domain Sequence, 5to 3
“A” adapter CGTATCGCCTCCCTCGCGCCATCAG
“B” adapter CTATGCGCCTTGCCAGCCCGCTCAG
341 F2 CCTACGGGNGGCWGCAG
341 F3 TCTACGGAAGGCTGCAG
926R1 CCGTCAATTCNTTTRAGT
926R3 CCGTCAATTTCTTTGAGT
926R4 CCGTCTATTCCTTTGANT