Skip to main content

Table 2 Primers designed for this study are illustrated

From: A gene-targeted approach to investigate the intestinal butyrate-producing bacterialcommunity

Functional genes - pyro-sequencing
buk_1F atcaaYccDggWtcWacWtcWac buk_1R acHgcYttYtgRtttaaWgcatg
buk_2F atWaatccWggttcWacWtcWacMaa buk_2R tgcYttYtggttgagygc
buk_3F atMaaTccWggBtcKacMtcaact buk_3R gccttctgRttMagKgcatg
but_1F cagctIggYatYggIgS but_1R aaRtccaIYtgIccVcc
but_2F ggWatWggMgsYatgcc but_2R aaRtcaaSctgKccDc
but_3F gHatYggIgStatgcc but_3R aagtcWaaYtgwccRcc
Functional genes - quantitative PCR
G_buk_F tgctgtWgttggWagaggYgga G_buk_R gcaacIgcYttttgatttaatgcatgg
G_Acida_F cgcagaagaacattgacaagg G_Acida_R atggcagggttattgtctacataatc
G_Fprsn_F gacaagggccgtcaggtcta G_Fprsn_R ggacaggcagatRaagctcttgc
G_RosEub_F tcaaatcMggIgactgggtWga G_Ros_R tcgataccggacatatgccaKgag
G_Eub_R tcataaccgcccatatgccatgag
16S genes - quantitative PCR
Cbuty_F tactctgtaatggaggaagccact Cbuty_R ggtacaatgagatgcaacctcgc
FPR-2F a ggaggaagaaggtcttcgg Fprau645R a Aattccgcctacctctgcact
Rrec630F a cgKactagagtgtcggagg Erec870R a agtttYattcttgcgaacg
RrecRi630F a gtcatctagagtgtcggagg
1132F b atggYtgtcgtcagctcgtg 1108R b Gggttgcgctcgttgc
  1. Degenerate bases are shown in capital letters. The following sequences aretargeted: buk_F/R - butyrate kinase (buk) genes; but_F/R -butyryl-CoA:acetate CoA-transferase (but) genes; G_buk_F/R -buk genes of Clostridium acetobutylicum, C.butyricum, C. perfringens; G_Acida - but genes ofAcidaminococcus sp.; G_Fprsn - but genes ofFaecalibacterium prausnitzii; G_RosEub, G_Ros_R, G_Eub_R -but genes of Eubacterium rectale and Roseburiasp; Cbuty_F/R -16S genes of C. butyricum; FPR-2 F, Fprau645R- 16S genes of F. prausnitzii; Rrec630F, RrecRi630F, Erec870R - 16Sgenes of E. rectale and Roseburia sp.; 1132 F, 1108R- universal for 16S. a Primers described in Ramirez-Farias etal.[18]; bPrimers described in Leigh et al.[19]. For more details on targeted sequences seeAdditional file 1: Table S1 and S2.