Spatial organization of the kelp microbiome at micron scales

Microbiome

Table 1 FISH probes used in this study

Probe	Target taxon	Probe sequence 5′–3′	Fluorophore	Reference
Eub338-I	Bacteria	GCTGCCTCCCGTAGGAGT	Dy490 or Atto532	[22]
Eub338-II	Planctomycetes	GCAGCCACCCGTAGGTGT	Dy415	[23]
Eub338-III	Verrucomicrobia	GCTGCCACCCGTAGGTGT	Dy415	[23]
Alf968	Alphaproteobacteria	GGTAAGGTTCTGCGCGTT	Dy490 or Atto620	[24]
Gam42a	Gammaproteobacteria	GCCTTCCCACATCGTTT	Cy5	[25]
Bac1058	Bacteroidetes	TGAATGGCTGCTTCCAAGCCAACA	Rhodamine Red-X	[26]
Gran737	Granulosicoccus sp.	TCAGCGTCAGTATTGTTCCAGA	Texas Red-X	This study
Gran670	Granulosicoccus sp.	CACCGCTACACCCGGAATTCCGC	Texas Red-X	This study

Probe name, target taxon, 5′–3′ sequence, fluorophores used, and references are indicated

ISSN: 2049-2618