Skip to main content

Table 1 Primers used for RT-qPCR of endogenous reference gene and target genes

From: Cross-kingdom inhibition of bacterial virulence and communication by probiotic yeast metabolites

Gene Function Forward sequences (5′–3′) Reverse sequences (5′–3′)
mdh Regulate malate dehydrogenase CTGGCGGCATTGGTCAAGCCC ACCCGGTGTGACAGGCGCAA
vpsT Vibrio polysacchaired transcriptional regulator CGCAGTATTCAGATGCTGGTG GACCTCTTTCGCATCAGGACA
ctxA Cholerae toxin subunit A AGCAGTCAGGTGGTCTTATGC CCCGTCTGAGTTCCTCTTGC
aphA Virulence gene regulator ACCGGGTACGATATAACCAAAGAG GATGGCTGGCTTTCCAGAAG
toxT Transcription activator of virulence genes TGACGCATACCCATCGACAG TCACCAGCTAAAAGCCGAGC
tcpH Toxin-co-regulated pilus TGTTTGGCTTACCCAGACCG TTCTGAGAGCTAGGATCTGGC
tcpP Toxin-co-regulated pilus ATTGCATATCAGTCTGGGTTTGC TCACTTGGTGCTACATTCATGG