Skip to main content

Table 1 Sequences, annealing temperatures, fragment length, and sources of the implemented qPCR primers. The primers for Vishniacozyma and Plectospaerella were designed with deposited sequences (accession numbers provided) in the NCBI database and the Primer-BLAST tool [53]

From: Microbiome-driven identification of microbial indicators for postharvest diseases of sugar beets

Taxonomic group Forward primer Reverse primer Length (bp) Annealing temp (°C) Reference/source
Vishniacozyma CGCATCGATGAAGAACGCAG AAAACCCAAGTGGGGTGAGG 151 64.6 NR_073260.1, this study
Plectospaerella ATCTCTTGGCTCCAGCATCG GATACTGGAAGGCGCCATGT 112 65 GU724980.1, this study
Candida TCTAACGTCTATGCGAGTG ATACCCAAATTCGACGATCG 244 59.4 [54]
Fusarium CAACTCCCAAACCCCTGTGA GCGACGATTACCAGTAACGA 398 58 [55]
Lactobacillus GCAGCAGTAGGGAATCTTCCA GCATTYCACCGCTACACATG 342 62.1 [56]
Penicillium ATGAAATCCTCCCTGTGGGTTAGT GAAGGATAATTTCCGGGGTAGTCATT 92 65 [57]