Skip to main content

Table 4 16S rRNA PCR primers for V4 region plus illumina adapter

From: The association between pneumococcal vaccination, ethnicity, and the nasopharyngeal microbiota of children in Fiji

Region Product size (bp)* Primer Sequence (5′ > 3′)
V4 ~ 250 515F TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG GTGCCAGCMGCCGCGGTAA
806R GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GGACTACHVGGGTWTCTAAT
  1. *Exact product size varies between bacterial species. Illumina adapter sequence is underlined