Skip to main content

Table 1 DNA primers used for qPCR assay to determine the relative abundance of bacterial group in mice fecal samples

From: Interactions between a pathogenic Blastocystis subtype and gut microbiota: in vitro and in vivo studies

Target Sequences (5′ → 3′) Reference
16S rRNA (total bacteria)   [35]
 Forward ACTCCTACGGGAGGCAGCAGT
 Reverse GTATTACCGCGGCTGCTGGCAC
Bacteroides sp.   [35]
 Forward GTCAGTTGTGAAAGTTTGC
 Reverse CAATCGGAGTTCTTCGTG
Lactobacillus sp.   [36]
 Forward AGCAGTAGGGAATCTTCCA
 Reverse CACCGCTACACATGGAG
Bifidobacterium sp.   [35]
 Forward AGGGTTCGATTCTGGCTCAG
 Reverse CATCCGGCATTACCACCC
E. coli   [35]
 Forward CATGCCGCGTGTATGAAGAA
 Reverse CGGGTAACGTCAATGAGCAAA