Skip to main content

Table 1 Primer sequence 5′-3′ for the gene expression determined by qPCR

From: The effect of the timing of exposure to Campylobacter jejuni on the gut microbiome and inflammatory responses of broiler chickens

Target gene Primer sequence (5′-3′) Product size (bp) NCBI accession number Reference
GAPDH F: GACGTGCAGCAGGAACACTA
R: TCTCCATGGTGGTGA AGACA
343 NM_204305.1 [29]
IFN-γ F: TGAGCCAGATTGTTTCGATG
R: CTTGGCCAGGTCCATGATA
152 NM_205149.1 [29]
IL-1β F: GGATTCTGAGCACACCACAGT
R: TCTGGTTGATGTCGAAGATGTC
272 NM_204524.1 [29]
IL-4 F: GGAGAGCATCCGGATAGTGA
R: TGACGCATGTTGAGGAAGAG
186 NM_001007079.1 [29]
IL-10 F: GCTGCGCTTCTACACAGATG
R: TCCCGTTCTCATCCATCTTC
203 NM_001004414.2 [29]
IL-6 F: GCTCGCCGGCTTCGA
R: GGTAGGTCTGAAAGGCGAACAG
71 NM_204628.1 [30]
IL17-A F: CATGGGATTACAGGATCGATGA
R: GCGGCACTGGGCATCA
68 NM_204460.1 [31]
IL17-F F: TGACCCTGCCTCTAGGATGATC
R: GGGTCCTCATCGAGCCTGTA
78 XM_426223.5 [31]
ChCXCLi1 F: CCGATGCCAGTGCATAGAG
R: CCTTGTCCAGAATTGCCTTG
191 NM_205018.1 [32]
ChCXCLi2 F: CCTGGTTTCAGCTGCTCTGT
R: GCGTCAGCTTCACATCTTGA
128 NM_205498.1 [32]