Skip to main content

Table 2 Description of primers used in PCR and quantitative PCR

From: A comprehensive method for amplicon-based and metagenomic characterization of viruses, bacteria, and eukaryotes in freshwater samples

Target gene Primer name and sequences (5′ ➔ 3′) Amplicon size (bp) Thermal program References
18S rRNA EuK1A: CTGGTTGATCCTGCCAG
499R: CACCAGACTTGCCCTCYAAT
~500 94 °C × 5 min, 35 cycles of 30 s at 94 °C, 60 s at 55 °C, and 90 s at 72 °C, and a final cycle of 10 min at 72 °C. [40, 41]
ITS ITS1: TCCGTAGGTGAACCTGCGG
ITS4: TCCTCCGCTTATTGATATGC
~500 95 °C × 15 min, 35 cycles of 30 s at 95 °C, 30 s at 55 °C, and 90 s at 72 °C, and a final cycle of 10 min at 72 °C. [42]
β-tubulin (qPCR) BT107F: AACAACTGGGCIAAGGTYACTACAC
BT261R: ATGAAGAAGTGGAGICGIGGGAA
~450 Initial denaturation 20 s at 95 °C, followed by 40 cycles of 1 s at 95 °C and 30 s at 60 °C. [43]
16S rRNA 341F: CCTACGGGAGGCAGCAG
R806: GGACTACHVGGGTWTCTAAT
~465 94 °C × 5 min, 35 cycles of 45 s at 94 °C, 45 s at 50 °C, and 60 s at 72 °C, and a final cycle of 10 min at 72 °C. [44, 45]
cpn60 H279: GAIIIIGCIGGIGAYGGIACIACIAC
H280: YKIYKITCICCRAAICCIGGIGCYTT
H1612: GAIIIIGCIGGYGACGGYACSACSAC
H1613: CGRCGRTCRCCGAAGCCSGGIGCCTT
~578 3 min at 94 °C, 40 cycles of 30 s at 94 °C, followed by a temperature gradient of 1 min at 42 °C, 48 °C, 54 °C, or 60 °C, and 1 min at 72 °C, followed by a final extension of 10 min at 72 °C. [46]
16S rRNA (qPCR) 341F: CCTACGGGAGGCAGCAG
518R: ATTACCGCGGCTGCTGG
~194 Incubation 2 min at 50 °C. Initial denaturation 20 s at 95 °C, followed by 40 cycles of 1 s at 95 °C and 20 s at 60 °C. [44]
uidA (qPCR) 784F: GTGTGATATCTACCCGCTTCGC
866R: GAGAACGGTTTGTGGTTAATCAGGA
EC807: FAM-TCGGCATCCGGTCAGTGGCAGT-BHQ1
84 Incubation 2 min at 50 °C. Initial denaturation 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. [47]
g23 (qPCR) MZIA1bis: GATATTTGIGGIGTTCAGCCIATGA
MZIA6: CGCGGTTGATTTCCAGCATGATTTC
~471 94 °C × 1.5 min, 35 cycles of 45 s at 94 °C, 60 s at 50 °C, and 60 s at 72 °C, and a final cycle of 5 min at 72 °C. Incubation 2 min at 50 °C. Initial denaturation for 20 s at 95 °C, 40 cycles of 1 s at 95 °C and 30 s at 60 °C. [20]
RdRp RdRp1: GGRGAYTACASCIRWTTTGAT
RdRp2: MACCCAACKMCKCTTSARRAA
~450 94 °C × 75 s, 40 cycles of 45 s at 94 °C, 45 s at 50 °C, and 60 s at 72 °C, and a final cycle of 5 min at 72 °C. [26]